View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4695_high_9 (Length: 267)
Name: NF4695_high_9
Description: NF4695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4695_high_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 44 - 267
Target Start/End: Original strand, 40410669 - 40410892
Alignment:
| Q |
44 |
tactgagcccttgaacattacccttctctaactatttattagtcaaggagagtaggatcctttgccaaaatagcttccatgagaagccaaactaccttat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40410669 |
tactgagcccttgaacattacccttctctaactatttattagtcaaggagagtaggatcctttgccaaaatagcttccatgagaagccaaactaccttat |
40410768 |
T |
 |
| Q |
144 |
ttagaatcccgttgaataatatgcaccataatctcttttgcagatgcaataaatttgagagataaaagtatgattttttagttgatagcaagacaaaatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
40410769 |
ttagaatcccgttgaataatatgcaccataatctcttttgcagatgcaataaatttgagagataaaagtatgactttttagttgatagcaagacaaattt |
40410868 |
T |
 |
| Q |
244 |
gttagctggaatcaaagtttggac |
267 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40410869 |
gttagctggaatcaaagtttggac |
40410892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University