View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4695_low_3 (Length: 369)
Name: NF4695_low_3
Description: NF4695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4695_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 4e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 40410887 - 40411051
Alignment:
| Q |
1 |
ttggacttcatttttagtactcctttcaacatcatcttgacaatattaataatatcagttagcgatatatactatctctgacaacagataaaatgtatta |
100 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| | |||||||| |||||||||| ||||||| |||| | |
|
|
| T |
40410887 |
ttggacttcatttttagtactgat--caacatcatcttgacaatattaataatatcagttagctacatatactacctctgacaacggataaaaggtatga |
40410984 |
T |
|
| Q |
101 |
tataacttagaacatatatacttccatatattattgccctcccaactattaaatcattgagatggcaacat |
171 |
Q |
| |
|
| ||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40410985 |
tctaacttagaac----atacttccatatattattgccctcccaactattaaatcatagagatggcaacat |
40411051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 271 - 359
Target Start/End: Original strand, 40411527 - 40411612
Alignment:
| Q |
271 |
ataattgcttgccgaatactactgctagtacaaagtgtacaaccttgttacatgatatatataagctgaatacgtacgttgtccttcat |
359 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40411527 |
ataattgcttgccgaatactact---agtacaaagtgtacaaccttgttacatgatatatataaactgaatacgtacgttgtccttcat |
40411612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University