View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4695_low_6 (Length: 355)
Name: NF4695_low_6
Description: NF4695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4695_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 16 - 343
Target Start/End: Original strand, 14195876 - 14196200
Alignment:
| Q |
16 |
aaaagaattgaataggatctggaatgatagttataatgatgcaatgattccaaggccttattatcattgcatatctctaaaatatttgcaatcatttatc |
115 |
Q |
| |
|
|||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14195876 |
aaaagaattgaatacgatctggactgatagtaataatgatgcaatgattccaaggccttattatcattgcatatctctaaaatatttgcaatcatttatc |
14195975 |
T |
|
| Q |
116 |
tcataaaaatccaaaaatactactttttattggcacactgaggagaacaagatagtgttgagattcacattttctatgggatcgatatttttattacgac |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14195976 |
tcataaaaatccaaaaatactactatttattggcacactgaggagaacaaaatagtgtcgagattcacattttctgtgggatcgatatttttattacgac |
14196075 |
T |
|
| Q |
216 |
agtaaaatcatgcacttgcgaacatagagtttttagtattgttgtgggggacttgttgaatatcggggtgannnnnnnnnnncaagttagtataattttc |
315 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
14196076 |
agtaaaatcgtgcacttgcggtcatagagtttttagtattgttgtgggggacttgttgaaaatcggggtga---tttttttccaagttagtataattttc |
14196172 |
T |
|
| Q |
316 |
ttattattttgttttactatcaccgtga |
343 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
14196173 |
ttattattttgttttactatcaccgtga |
14196200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University