View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4696-Insertion-8 (Length: 106)
Name: NF4696-Insertion-8
Description: NF4696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4696-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 8 - 106
Target Start/End: Complemental strand, 48475520 - 48475422
Alignment:
| Q |
8 |
atattaacaatcaaaatagctaatactttttatttaaacaatcaaaattgaagctttattgagtttgatgttgtgtgatttttgttgagaatcgtacca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48475520 |
atattaacaatcaaaatagctaatactttttattcaaacaatcaaaattgaagctttattgagtttgatgttgtgtgattttggttgagaatcgtacca |
48475422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University