View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4696_high_13 (Length: 248)
Name: NF4696_high_13
Description: NF4696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4696_high_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 42658909 - 42658669
Alignment:
| Q |
8 |
gatgaacattttcatccttttaagacaaagattacgcagtcatcaggcgcatgagcatatatatacattaatagcaacttctacatatgtcaaactacac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42658909 |
gatgaacattttcatccttttaagacaaagattacgcagtcatcaggcgcatgagcatatatatacattaatagcaacttctacatatgtcaaactacac |
42658810 |
T |
 |
| Q |
108 |
aaatcataatgaacattataaaacttcataaaatacaatagaaagagcattataaatcacttaatggaagataaaatacctgtaggtcccccgatgttaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42658809 |
aaatcataatgaacattataaaacttcataaaatacaatagaaagagcattataaatcacttaatggaagataaaatacctgcaggtcccccgatgttaa |
42658710 |
T |
 |
| Q |
208 |
ccacaagcaagggctttggcagtgtagctaactcattatgc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42658709 |
ccacaagcaagggctttggcagtgtagctaactcattatgc |
42658669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University