View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4696_high_3 (Length: 431)
Name: NF4696_high_3
Description: NF4696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4696_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 1 - 415
Target Start/End: Complemental strand, 39418754 - 39418334
Alignment:
| Q |
1 |
cagcagaggatgacaacacatttggttgggataacaaacatgttggagcaaggatacttctttcaaaggtcctaaatttgacaacatatcatcaaacaaa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
39418754 |
cagcagagtttgacaacacatttggttgggataacaaacatgttggagcaaggatacttctttcaaaggtcctaaatttcacaacatagtatcaaacaaa |
39418655 |
T |
 |
| Q |
101 |
atatcactaatgatttaaacctaacatgnnnnnnnatttt------gtggttttaggaatttctagttcaaagggtaagatccctccatgactacaaggg |
194 |
Q |
| |
|
||||| ||||| |||||| |||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39418654 |
ttatcaataatgttttaaaactaacatgttttttttttttttttttgtgattttaggaatttctagttcaaagggtaagatccctccatgactacaaggg |
39418555 |
T |
 |
| Q |
195 |
tcattcagacaattttgtttgctctttaattcctggagctggatcctcttctgcacaatatacccctggtaaggtccctctttcttctctttcagtatta |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39418554 |
tcattcagacaattttgtttgctctttaattcctggagctggatcctcttctgcacaatatacccctggtaaggtccctctttcttctctttcagtatta |
39418455 |
T |
 |
| Q |
295 |
acgctattggtttcatgtggtccaagatgtaactgtttttgagcttgtgaaactttacaggtgggcttttgttcaagatgagtgatagtaacatgcagta |
394 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39418454 |
actctattggtttcatgtggtccaagatgtaactgtttttgagcttgtgaaactttacaggtgggcttttgttcaagatgagtgatagtaacatgcagta |
39418355 |
T |
 |
| Q |
395 |
tgtcacatccactagcttctt |
415 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39418354 |
tgtcacatccactagcttctt |
39418334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 21 - 79
Target Start/End: Original strand, 44512021 - 44512079
Alignment:
| Q |
21 |
tttggttgggataacaaacatgttggagcaaggatacttctttcaaaggtcctaaattt |
79 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||| ||||| ||||||| |||||| |
|
|
| T |
44512021 |
tttggatgggataacaaacatgctggagcaaggatactcctttctaaggtccaaaattt |
44512079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 360 - 406
Target Start/End: Original strand, 44513058 - 44513104
Alignment:
| Q |
360 |
cttttgttcaagatgagtgatagtaacatgcagtatgtcacatccac |
406 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
44513058 |
cttttgttcaagatgaatgatagtaacatgcaatatgtcacgtccac |
44513104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University