View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4696_low_12 (Length: 252)
Name: NF4696_low_12
Description: NF4696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4696_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 39418781 - 39418904
Alignment:
| Q |
1 |
atgtaatttaggtacattggattctttgtagctttgtgtaaccaagcagcaccccacaacaactcatcctaacaagtcattacaaacccatcagtcaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39418781 |
atgtaatttaggtacattggattctttgtggctttgtgtaaccaagcagcaccccacaacaactcatcctaacaagtcattacaaacccatcagtcaaaa |
39418880 |
T |
 |
| Q |
101 |
gtactataattttgagtatgactc |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39418881 |
gtactataattttgagtatgactc |
39418904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 170 - 250
Target Start/End: Original strand, 39418950 - 39419030
Alignment:
| Q |
170 |
ctttacctgataaccagagtaatcacagtaaaagggacacacaaagggttttaagacattgctgtaaggtcctctgtgttg |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39418950 |
ctttacctgataaccagagtaatcccagtaaaagggacacacaaagggttttaagacattgctgtaaggtcctctgtgttg |
39419030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 44511974 - 44511906
Alignment:
| Q |
1 |
atgtaatttaggtacattggattctttgtagctttgtgtaaccaagcagcaccccacaacaactcatcc |
69 |
Q |
| |
|
||||| |||| ||||||| | ||||| || || ||||| | |||||||||||||||||||||||||||| |
|
|
| T |
44511974 |
atgtagtttaagtacattaggttcttagtggccttgtgaagccaagcagcaccccacaacaactcatcc |
44511906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University