View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4696_low_7 (Length: 301)
Name: NF4696_low_7
Description: NF4696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4696_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 42153026 - 42152760
Alignment:
| Q |
19 |
gttctgattaattgtttttaggcactgattaatattttttatagagttaacatgacttataaaataagtttggcaagcataatatcggtttctatttttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42153026 |
gttctgattaattgtttttaggcactgattaataatttttatagagttaacatgacttataaaataagtttggcaagcataatatcggtttctatttttc |
42152927 |
T |
|
| Q |
119 |
aaataatcataacttggactaacaaactgtatttttatcagccaatatccaagtaaccttctagcaaagttaacttgtggggatcagcaagttgagttat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42152926 |
aaataatcataacttggactaacaaactgtatttttatcagccgatatccaagtaaccttctagcaaagttaacttgtggggatcaacaagttgagttat |
42152827 |
T |
|
| Q |
219 |
aagtcaatatcagataattaatgtaggataaagcagggcttgcagatataaaagcaaaattgttcat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42152826 |
aagtcaatatcagataattaatgtaggataaagtagggcttgcagatataaaagcaaaattgttcat |
42152760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University