View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4698-Insertion-13 (Length: 329)
Name: NF4698-Insertion-13
Description: NF4698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4698-Insertion-13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 8 - 324
Target Start/End: Original strand, 23766789 - 23767105
Alignment:
| Q |
8 |
accaccgctaggagaagtggaaaataaggattcaatctcatgagatagatcaagtgcaacatgaggatgacaacaaccttttcgttttgtagattgacgc |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23766789 |
accaccgcttggagaagtggaaaataaggattcaatctcatgagatagatcaagtgcaacatgaggatgacaacaaccttttcgttttgtagattgacgc |
23766888 |
T |
|
| Q |
108 |
agttgttttggttttctaggtggaggtggaagaatcacttgaattttgtgttccatggatgttggagccttgaaaccgtcgtttaatgaatcaatatctt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
23766889 |
agttgttttggttttctaggtggaggtggaagaatcacttgaattttgtgttccatggatgttggagtcttgaaaccgtcgtttaatggatcaatatctt |
23766988 |
T |
|
| Q |
208 |
tctcttcctcgtacgatggaacattgatcttcaaattcaaaggaacatttttgtgttgtttttcttcatgttgttgcactagttgcttttttggcttaag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23766989 |
tctcttcctcgtacgatggaacattgatcttcaaattcaaaggaacatttttgtgttgtttttcttcatgttgttgcactagttgcttttttggcttaag |
23767088 |
T |
|
| Q |
308 |
ctctttcattattgaag |
324 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
23767089 |
ctctttcattattgaag |
23767105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University