View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4698-Insertion-16 (Length: 121)
Name: NF4698-Insertion-16
Description: NF4698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4698-Insertion-16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 7 - 121
Target Start/End: Complemental strand, 49911158 - 49911044
Alignment:
| Q |
7 |
agagagaagatgagtgctagcttttccatcttttagctcccaaactcaccaaaagattaaaaacccattggttcattcaacacataattaaaaccttcaa |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49911158 |
agagagaaggtgagtgctagcttttccatcttttagctcccaaactcaccaaaagattaaaaccccattggttcattcaacacataattaaaaccttcaa |
49911059 |
T |
 |
| Q |
107 |
ttttcgcttttagcc |
121 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49911058 |
ttttcgcttttagcc |
49911044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University