View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4698-Insertion-17 (Length: 119)
Name: NF4698-Insertion-17
Description: NF4698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4698-Insertion-17 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 49; Significance: 2e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 26 - 119
Target Start/End: Original strand, 21980247 - 21980345
Alignment:
| Q |
26 |
ttatttcttatgagagagtaaggtaaaactaaatttattctattctcgtcct----nnnnnnnggct-aacatactagtatatcactactgatctgtag |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21980247 |
ttattttttatgagagagtaaggtaaaactaaatttattctattctcgtcctaaaaaaaaaaaggctaaacatactagtatatcactactgatctgtag |
21980345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 6e-16
Query Start/End: Original strand, 23 - 77
Target Start/End: Original strand, 21981280 - 21981334
Alignment:
| Q |
23 |
aagttatttcttatgagagagtaaggtaaaactaaatttattctattctcgtcct |
77 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21981280 |
aagttattacttatgagagagtaccgtaaaactaaatttattctattctcgtcct |
21981334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University