View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4698_high_2 (Length: 419)
Name: NF4698_high_2
Description: NF4698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4698_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 16 - 412
Target Start/End: Complemental strand, 41934183 - 41933786
Alignment:
| Q |
16 |
catagattgtttaattgatgaatgattccgaggaaatacacacacaatgtgtgttgtttgtttgacaccctctcatggtgatcttttctgaacctcggga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41934183 |
catagattgtttaattgatgaatgattccgaggaaatacacacacaatgtgtgttgtttgtttgacaccctctcatggtgatcttttctgaacctcggga |
41934084 |
T |
|
| Q |
116 |
aacaaatagttaacatttaaaccagcaagtgctttggtctgcacactctggtcgggttggatcagatactcagtccgtgtctcctcttctaatgctttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41934083 |
aacaaatagttaacatttaaaccagcaagtgctttggtctgcacactctggtcgggttggatcagatactcagtccgtgtctcctcttctaatgctttct |
41933984 |
T |
|
| Q |
216 |
cactatatcaaagaaaatatgttcactgtttcatccaccttgtc-ttttggagttaagggaagaaccagtaacattgtgtgtcacaccacaaaacacttt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41933983 |
cactatatcaaagaaaatatgttcactgtttcatccaccttgtctttttggagttaagggaagaaccagtaacattgtgtgtcacaccacaaaacacttt |
41933884 |
T |
|
| Q |
315 |
gacataaatactattctgctagtaaactcaacaacattgccacccatatcatcaacactattttggtacctgttttcattttcagatcacctatgcta |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41933883 |
gacataaatactattctgctagtaaactcaacaacattgccacccatatcatcaacactattttggtacctgttttcattttcagatcacctaggcta |
41933786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University