View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4698_high_4 (Length: 360)
Name: NF4698_high_4
Description: NF4698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4698_high_4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 360
Target Start/End: Complemental strand, 39076098 - 39075755
Alignment:
| Q |
17 |
atgaagacatgggaagattaagatggacacattttgatgatacacaaaatttatctttgtggtattatttatgttctctccttattgtaaccatttacat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076098 |
atgaagacatgggaagattaagatggacacattttgatgatacaaaaaatttatctttgtggtattatttatgttctctccttattgtaaccatttacat |
39075999 |
T |
|
| Q |
117 |
tggtgnnnnnnnnnnnnnnnnnaagcaattggaagtgggttcactacttccttcgaaccaatgctgctagatatatttaattattatcatgtattatttc |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39075998 |
tggtgttttttatgtgttttttaagcaattggaagtgggttcactacttccttcgaaccaatgctgctagatatatttaattattatcatgtattatttc |
39075899 |
T |
|
| Q |
217 |
gtgatatactttgctcaattaatacatggctttgtgctggattttggtttgattcttattgtatattttcatggtagaataatattagtttataggtcca |
316 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||| || ||||||||||||||| |
|
|
| T |
39075898 |
gtgatatactttactcaattaatacatggctttgtgctggattttgttttgattcttattgtatatttgcagggtagaaaaagcatagtttataggtcca |
39075799 |
T |
|
| Q |
317 |
atataaagtaacaacagagatttaattcatgttcttgctaaacc |
360 |
Q |
| |
|
|||||||||||||| ||| |||| |||||| ||||||||||||| |
|
|
| T |
39075798 |
atataaagtaacaatagatatttcattcatattcttgctaaacc |
39075755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University