View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4698_low_13 (Length: 243)
Name: NF4698_low_13
Description: NF4698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4698_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 2176876 - 2176811
Alignment:
| Q |
1 |
ttctattttggctcttcatccctcttttacaattgcatttttaaaactcaatcatcattgagcatt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2176876 |
ttctattttggctcttcatccctcttttacaattgcatttttaaaactcaatcatcattgaacatt |
2176811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 177 - 225
Target Start/End: Complemental strand, 2176646 - 2176598
Alignment:
| Q |
177 |
gcacttgataaggaatcaatgagaatccaatttaatagcatgcagaatc |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176646 |
gcacttgataaggaatcaatgagaatccaatttaatagcatgcagaatc |
2176598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 64 - 111
Target Start/End: Complemental strand, 2176760 - 2176713
Alignment:
| Q |
64 |
attctacttaaatctttggcacacttaaaattcaaaactgtctacacc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176760 |
attctacttaaatctttggcacacttaaaattcaaaactgtctacacc |
2176713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University