View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4698_low_18 (Length: 206)
Name: NF4698_low_18
Description: NF4698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4698_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 12626686 - 12626779
Alignment:
| Q |
1 |
tgatgagaagctaagaggtgaccgatcaattggaaaaataatgtgaaagaggaaattatgttacaacaattgaagaaaagtagaataaattgga |
94 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12626686 |
tgatgagaagctaagaggtggccgatcaattggaaaaataatgtgaaagaggaaattatgttacaacaattgaagaaaagtagaataaattgga |
12626779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 119 - 206
Target Start/End: Original strand, 12628925 - 12629012
Alignment:
| Q |
119 |
taggaatcttaacaaattacatccaattaaaataggaaaagacaaagggaaggaacagaggtatattattattataagaaaagaaata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12628925 |
taggaatcttaacaaattacatccaattaaaataggaacagaaaaagggaaggaacaaaggtatattattattataagaaaagaaata |
12629012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University