View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4698_low_7 (Length: 348)
Name: NF4698_low_7
Description: NF4698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4698_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 104 - 333
Target Start/End: Complemental strand, 5037680 - 5037451
Alignment:
| Q |
104 |
actgcactcaggttacctaagccccgacggttccaactaataatacttaattattctaatgagatgtcatgccatagatcatggagaacttccaaccnnn |
203 |
Q |
| |
|
|||||||| ||||||| || |||| || |||| ||||| ||||| | ||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
5037680 |
actgcacttgggttacccaaaccccaacagttctaactagtaatattcaattattctaatgagatgtcatgccatggatcaaggagaacttccaaccaga |
5037581 |
T |
 |
| Q |
204 |
nnnncggtccatgtttaatagaaaatatcaacagtacaaaattacaacaatcatacctaatcatcattgatgagtgaatatccagctgagaatgtcacaa |
303 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
5037580 |
aaaatagtccacatttaatagaaaatatcaacggtacaaaattacaacaatcatacctaatcatcattgatgagtgaatattcagctgagaatgccacaa |
5037481 |
T |
 |
| Q |
304 |
acagtgcagatagaacacaaatttcttcat |
333 |
Q |
| |
|
|| |||||||||||||||||||||||||| |
|
|
| T |
5037480 |
actatgcagatagaacacaaatttcttcat |
5037451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 5037754 - 5037677
Alignment:
| Q |
1 |
caatacataacgcaaatcacttatattatttgaatacatgaaattctcatacaatatcatagcattcgtcttatactg |
78 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
5037754 |
caatacacaacgcaaatcacttatattatttgaattcatgaaattctcctacaatatcatagcattcatcttatactg |
5037677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University