View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4699-Insertion-13 (Length: 297)
Name: NF4699-Insertion-13
Description: NF4699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4699-Insertion-13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 92 - 295
Target Start/End: Complemental strand, 38999732 - 38999530
Alignment:
| Q |
92 |
ttatacttgtaattgattttattagttataattttattagttataaacacataggaaatgttaatccttttttaaactggcagtgtatctattaaacttg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999732 |
ttatacttgtaattgattttattagttataattttattagttataaacacataggaaatgttaatccttttttaaactggcagtgtatctattaaacttg |
38999633 |
T |
|
| Q |
192 |
taattgatttagcaacaatgatttagcacatattctttaatttatgcacaaataaccaatgtcatccaatgtggaagttgatgatactagttttatttct |
291 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999632 |
taattgatttaacaacaatgatttagcacat-ttctttaatttatgcacaaataaccaatgtcatccaatgtggaagttgatgatactagttttatttct |
38999534 |
T |
|
| Q |
292 |
caac |
295 |
Q |
| |
|
|||| |
|
|
| T |
38999533 |
caac |
38999530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 7 - 57
Target Start/End: Complemental strand, 38999783 - 38999733
Alignment:
| Q |
7 |
atgtatttcttaggacaatctaaaactgaggatatgaatcaggagcctata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38999783 |
atgtatttcttaggacaatctaaaactgaggatatgaatcaggagcctata |
38999733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University