View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4699_high_3 (Length: 676)
Name: NF4699_high_3
Description: NF4699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4699_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 208 - 565
Target Start/End: Original strand, 33107112 - 33107464
Alignment:
| Q |
208 |
cttaatgcaaaagttatgttgtgttttgttatgagttaaaagttatgacaaagaggttctgttctgttttagtggaagagaggttccttagtgggaggcc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33107112 |
cttaatgcaaaagttatgttgtgttttgttatgagttaaaagttatgacaaagaggttctgtt-----ttagtggaagagaggttccttagtgggaggcc |
33107206 |
T |
|
| Q |
308 |
cccactttttagtttttaagcaattagaagttagaataggaagcacaaacataactttctgcnnnnnnncttcttataataatataatttataacttttt |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33107207 |
cccactttttagtttttaagcaattagaagttagaataggaagcacaaacataactttctgctttttttcttcttataataatataatttataacttttt |
33107306 |
T |
|
| Q |
408 |
catcattcatagaatctgggatctctttttactcaaatcatttgtggattccaatttcatcattcttttgtctaacttttgggataatattgtgctattg |
507 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107307 |
catcattcatagaatctgggatctctttttactcaaatcatttgttgattccaatttcatcattcttttgtctaacttttgggataatattgtgctattg |
33107406 |
T |
|
| Q |
508 |
ccaccccttatctcaaccagtattaagtaatacaaggaaacaaacaaaatagaaggtc |
565 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107407 |
ccaccccttatctcaaccagtattaagtaatacaaggaaacaaacaaaatagaaggtc |
33107464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 159; E-Value: 3e-84
Query Start/End: Original strand, 17 - 175
Target Start/End: Original strand, 33106911 - 33107069
Alignment:
| Q |
17 |
ataccatagattcctgcattgattctggattttagtgtcattctttggatatataaacacataccttctcactccatctatgtacctctaaatttccaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33106911 |
ataccatagattcctgcattgattctggattttagtgtcattctttggatatataaacacataccttctcactccatctatgtacctctaaatttccaac |
33107010 |
T |
|
| Q |
117 |
agctcaacttatgtttctctctcctcaatccaccaaggtgtaacaaacaagaaggtaaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107011 |
agctcaacttatgtttctctctcctcaatccaccaaggtgtaacaaacaagaaggtaaa |
33107069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University