View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4699_low_17 (Length: 213)
Name: NF4699_low_17
Description: NF4699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4699_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 38781402 - 38781204
Alignment:
| Q |
1 |
agaagttttcttcggcgacgtattgaccatgtacgaccagt-gacacatggcatcagccatgaaaggcaaagagaaatcttggggcaaaatcctagtacg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38781402 |
agaagttttcttcggcgacgtattgaccatgtacgaccagttgacacatggcaacagccatgaaaggcaaagagaaatcttggggcaaaatcctagtaca |
38781303 |
T |
 |
| Q |
100 |
ttcccctcacgagaatggtcacgttatctctaatcccccttttacagcttcttgtgtatcatacactaactggttgtgaatgtaacagtgtgtttctac |
198 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38781302 |
tccccctcacgagaatggtcacattatctctaatcccccttttacagcttcttgtgtatcatacactaactggttgtgaatgtaacagtgtgtttctac |
38781204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University