View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4699_low_6 (Length: 314)
Name: NF4699_low_6
Description: NF4699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4699_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 27 - 303
Target Start/End: Original strand, 38891209 - 38891489
Alignment:
| Q |
27 |
attcgttaacaagaacaatatataaaccaagttgatcacaaaaatataagaatgatagaaacagtttgtcagatcatagatatgtccaatcccatccatc |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38891209 |
attcgttaacaagaacaatatataaaccaagttgatcacaaaaatataagaatgatagaaacagtttgtcagatcatagatatgtccaatcccatccatc |
38891308 |
T |
|
| Q |
127 |
gaactgataagtttctttgcacagcaagaggcgtgaagtactaccaaaaggtcttgatggggctactatactatactttgcttttgaggatca----gga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38891309 |
gaactgataagtttctttgcacagcaagaggcgtgaagtactaccaaaagctcttgatggggctactatactatactttgcttttgaggatcaggatgga |
38891408 |
T |
|
| Q |
223 |
tcagattcagaagcaatagcaatagcaatagcaatagcaaagctagtttgatcattagtcatacactagttgttcattcat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38891409 |
tcagattcagaagcaatagcaatagcaatagcaatagcaaagctagtttgatcattagtcatgcactagttgttcattcat |
38891489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University