View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4700_high_4 (Length: 232)
Name: NF4700_high_4
Description: NF4700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4700_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 10 - 222
Target Start/End: Complemental strand, 9039350 - 9039138
Alignment:
| Q |
10 |
catcatcacggcattaggcaatgtcaaaacctcccaacaagcttgggatactctcaagaagatgtttgagagtaaaatacgtgctcatatcatgcatctt |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
9039350 |
catcatcacgacattaggcaatgtcaaatcctcccaacaagcttgggatactctcaagaagatgtttgcgagtaaaacacgtgctcgtatcatgcatctt |
9039251 |
T |
 |
| Q |
110 |
aaagagcgactcactcgaataaccaaaggagtgagtccgattgctgagtatcttcacaacattaaagcaactgctgatgaattagccatcaccaattcac |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9039250 |
aaagagcgactcactcgaattaccaaaggagtgagttcgattgctgaatatcttcacagcattaaagcaactgctgatgaattagccatcatcaattcac |
9039151 |
T |
 |
| Q |
210 |
cattggatgatgt |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9039150 |
cattggatgatgt |
9039138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 77
Target Start/End: Complemental strand, 40116309 - 40116258
Alignment:
| Q |
26 |
ggcaatgtcaaaacctcccaacaagcttgggatactctcaagaagatgtttg |
77 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
40116309 |
ggcaatgtgaaaacatctcaacaagcttgggataccctcaagaaaatgtttg |
40116258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University