View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4701-Insertion-6 (Length: 229)
Name: NF4701-Insertion-6
Description: NF4701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4701-Insertion-6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 8 - 190
Target Start/End: Complemental strand, 4477868 - 4477686
Alignment:
| Q |
8 |
attcatacttctataacgtgttgttactaacacaattgtactacaattttacatatatgtaaacttttttgctgctttggccaggatatcattattttct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
4477868 |
attcatacttctataacgtgttgttactaacacaattctactacaattttacatatatgtaaacttttttgctgctttggccaggatatcataatttttt |
4477769 |
T |
 |
| Q |
108 |
tattttttattattatgaaatggaaaaacatgtgaataagctcaaagatcaaacacaagacaagcaggaaaagaatacaatcc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4477768 |
tattttttattattatgaaatggaaaaacatgtgaataagctcaaagatcaaacacaagacaagcaggaaaagaatacaatcc |
4477686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University