View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4701_low_8 (Length: 273)

Name: NF4701_low_8
Description: NF4701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4701_low_8
NF4701_low_8
[»] chr7 (1 HSPs)
chr7 (1-254)||(36330485-36330738)


Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 36330738 - 36330485
Alignment:
1 atgctgagggaagacatgtgaggaggatacaaggaattactggtatgcctactgagacttttcaaggtaatgcagagaataagaagttgatgatgagtga 100  Q
    |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36330738 atgctgagggaagacatgtgaggatgatagaaggaattactggtatgcctactgagacttttcaaggtaatgcagagaataagaagttgatgatgagtga 36330639  T
101 tgcttttgatcctagttgcgaggttgttgtgtgtggtgatggactcattaccatagaggatcttcttaatccaaattttgttgatcacaataaactaaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36330638 tgcttttgatcctagttgcgaggttgttgtgtgtggtgatggactcattaccatagaggatcttcttaatccaaattttgttgatcacaataaactaaag 36330539  T
201 attagggttcaatcaattgagaagaatgctagaactatgcatacaccacttcca 254  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||    
36330538 attagggttcaatcaattgagaagaatggtagaactatgcatacaccacttcca 36330485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University