View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4701_low_9 (Length: 272)
Name: NF4701_low_9
Description: NF4701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4701_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 4477865 - 4478124
Alignment:
| Q |
1 |
gaatatcaaagtgtaagagttgggattttctcagtcttgcaatcttcgtcgacacctatatagtaaaatctatataattcaacagcagatcaccaaatgg |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4477865 |
gaatatcaaagtgtaaaagttgggattttcttagtcttgcaatcttcgtcgacacctagatagtaaaatctatataattcaacagcagatcaccaaatgg |
4477964 |
T |
 |
| Q |
101 |
tgaatatgtaaaatctaattaagtgattttatacaaccaaaaaatctctcaacccactacgtgtagaagtaaaaatatatatttatgagctataatttca |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4477965 |
tgaatatgcaaaatctaattaagtgattttatacatccaaaaaatctctcaacccactacgtgtagaagtaaaaatatatatttatgagctataatttca |
4478064 |
T |
 |
| Q |
201 |
acgtatattcataattcttagttcaaaacttgtaaatcaagctatcgatggttcatctca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4478065 |
acgtatattcataattcttagttcaaaacttgtaaatcaagctatcgatggttcatctca |
4478124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University