View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4702-Insertion-11 (Length: 207)
Name: NF4702-Insertion-11
Description: NF4702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4702-Insertion-11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 207
Target Start/End: Original strand, 45659000 - 45659200
Alignment:
| Q |
8 |
tttcaaatctttgtaatacaggcagatcaagaggaaactgaagaactcaagcttctcactgaatggaagagaaagaaaggtggattcagggcttctatgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45659000 |
tttcaaatctttgtaatacaggcagatcaagaggaaactgaagaactcaagcttctcactgaatggaagagaaagaaaggtggatttagggcttctatgt |
45659099 |
T |
 |
| Q |
108 |
ttatttttggtaagctgaagtataaacaaaaactctttgttggttctgttttttgctgatttgaa-tttgatgcaaaatatgttcttgttttttgatgta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
45659100 |
ttatttttggtaagctgaagtataaacaaaaactctttgttggttctgttttttgctgatttgaattttgatgcaaactatgttcttgttttttgatgta |
45659199 |
T |
 |
| Q |
207 |
g |
207 |
Q |
| |
|
| |
|
|
| T |
45659200 |
g |
45659200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University