View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4702_high_14 (Length: 246)
Name: NF4702_high_14
Description: NF4702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4702_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 50 - 229
Target Start/End: Complemental strand, 45659004 - 45658825
Alignment:
| Q |
50 |
tgaaactcatcaactatatgtatatagaaacaagctaaggttagaaaaatgagtgagatgaatgagtagaaccttaccattgtctcgataatgagagtta |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45659004 |
tgaaactcatcaactatatgtatatagaaacaagctaaggttagaaaaatgagtgagatgaatgagtagaaccttaccattgtctcgataatgagagtta |
45658905 |
T |
 |
| Q |
150 |
agttttagacaagaatagtaaagttcaaatgaaatggtgtttgtgaagaaatagctcaaaattgtttgcctctgtctgtg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45658904 |
agttttagacaagaatagtaaagttcaaatgaaatggtgtttgtgaagaaatagctcaaaattgtttgcctctgtctgtg |
45658825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University