View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4702_high_14 (Length: 246)

Name: NF4702_high_14
Description: NF4702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4702_high_14
NF4702_high_14
[»] chr7 (1 HSPs)
chr7 (50-229)||(45658825-45659004)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 50 - 229
Target Start/End: Complemental strand, 45659004 - 45658825
Alignment:
50 tgaaactcatcaactatatgtatatagaaacaagctaaggttagaaaaatgagtgagatgaatgagtagaaccttaccattgtctcgataatgagagtta 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45659004 tgaaactcatcaactatatgtatatagaaacaagctaaggttagaaaaatgagtgagatgaatgagtagaaccttaccattgtctcgataatgagagtta 45658905  T
150 agttttagacaagaatagtaaagttcaaatgaaatggtgtttgtgaagaaatagctcaaaattgtttgcctctgtctgtg 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45658904 agttttagacaagaatagtaaagttcaaatgaaatggtgtttgtgaagaaatagctcaaaattgtttgcctctgtctgtg 45658825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University