View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4702_low_12 (Length: 278)
Name: NF4702_low_12
Description: NF4702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4702_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 183 - 263
Target Start/End: Original strand, 52995256 - 52995336
Alignment:
| Q |
183 |
taatatataatgtcatagcagtattttatgggtaaactcaattctataatcattaattaattgatagtggtacatgtattt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52995256 |
taatatataatgtcatagcagtattttatgggtaaactcaattctataatcattaattaattgatagtggtacatgtattt |
52995336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 32 - 113
Target Start/End: Original strand, 52995070 - 52995150
Alignment:
| Q |
32 |
atacgattttaacaacgtctatcacaccatttttaaatagggaaatgttaattggtttacttgagatactgattaagattat |
113 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||| ||| ||||| ||||||| || |||||||| |
|
|
| T |
52995070 |
atacgattttaacaacgtctatcacactatttttaaataggaaaatgttaaccggtgtactt-agatactcatcaagattat |
52995150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University