View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4702_low_8 (Length: 298)
Name: NF4702_low_8
Description: NF4702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4702_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 3 - 289
Target Start/End: Complemental strand, 53853356 - 53853070
Alignment:
| Q |
3 |
atgagaataagaaattgttgataccggataagaagcttagtcaaaagaagtacaagcttacgtggtactaaaaattttatggtgatcaagctctttacgt |
102 |
Q |
| |
|
|||||||| ||||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53853356 |
atgagaatgagaaattgtggatactggataagaagctgagtcaaaagaagtacaagcttacgtggtactaaaaaatttatggtgatcaagctctttacgt |
53853257 |
T |
 |
| Q |
103 |
ggcaaacaaaaacaagtcagcttgcaactgagattacttggtttgctcttcaactaggagaccaaattgtgatatgttattcttcattattatatcctaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53853256 |
ggcaaacaaaaacaagtcagcttgcaactgagattacttggtttgctcttcaactaggagaccaaattgtgatatgttattcttcattattatatcctaa |
53853157 |
T |
 |
| Q |
203 |
attcaaagtggaagttgagaggagcatggccacgtatgcataacagggcatggcattacaacaacgccattatctttattcttcatc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
53853156 |
attcaaagtggaagttgagaggagcatggccacgtatgcataacagggcatggcattacaacaacaccattatctttattctacatc |
53853070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University