View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4703-Insertion-10 (Length: 449)
Name: NF4703-Insertion-10
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4703-Insertion-10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 7 - 311
Target Start/End: Complemental strand, 21838681 - 21838377
Alignment:
| Q |
7 |
aaatgtaacaaccaaatgttgtcaaagggtataaatgcatagccgtgcatgcaggcctgccttgcgcttagaaccatgaacacctttcatgtttttaaat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21838681 |
aaatgtaacaaccaaatgttgtcaaagggtataaatgcatagccgtgcatgcaggcctgccttgcccttagaaccatgaacacctttcatgtttttaaat |
21838582 |
T |
|
| Q |
107 |
tgcggtcgcgtttgcgattaggcaatgaatccttaaatcaggaaaaatacagtcaatgcagttgaaattgcgtttgcgacactagttgtgatagtattac |
206 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| || | |
|
|
| T |
21838581 |
tgcggtcgcgtttgcgattaggcagtgaatccttaaatcaggaaaaatacagtcaatgcagttgaaattgcgtttgcgatattagttgtgatagtgttcc |
21838482 |
T |
|
| Q |
207 |
gctgcgaagacctcaaaatcttttatattgcggacgacaattgaaaaccaggcctctcatagctgggttttgcagggtaaaaagcttgcaactgctaact |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21838481 |
gctgcgaagacctcaaaatcttttatattgcggacgacaattgaaaaccaggcctctcatagctgggttttgcagggaaaaaagcttgcaactgctaact |
21838382 |
T |
|
| Q |
307 |
agagg |
311 |
Q |
| |
|
||||| |
|
|
| T |
21838381 |
agagg |
21838377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 345 - 416
Target Start/End: Complemental strand, 21838343 - 21838272
Alignment:
| Q |
345 |
gaaaggatagaggttttatatattaattgtcagctttatctatccatagtattttacaaccttaaagaagtt |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21838343 |
gaaaggatagaggttttatatattaattgtcagctttatttatccatagtattttacaaccttaaagaagtt |
21838272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 214 - 243
Target Start/End: Original strand, 10978561 - 10978590
Alignment:
| Q |
214 |
agacctcaaaatcttttatattgcggacga |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10978561 |
agacctcaaaatcttttatattgcggacga |
10978590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University