View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4703_high_11 (Length: 257)
Name: NF4703_high_11
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4703_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 23332794 - 23332595
Alignment:
| Q |
14 |
gaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332794 |
gaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaa |
23332695 |
T |
|
| Q |
114 |
atcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccacatat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23332694 |
atcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
208 |
acatatgcgtttggattttacaacgattgtgtttgatgatgtc |
250 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
208 |
acatatgcgtttggattttacaacgattgtgtttgatgatgtc |
250 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University