View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4703_high_12 (Length: 255)
Name: NF4703_high_12
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4703_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 20 - 246
Target Start/End: Complemental strand, 25954151 - 25953922
Alignment:
| Q |
20 |
aacaatgtttagattagataacatgtgtctcttttaatttagggagagtttgctgcccaattggatcacaaaaaactcgagaaattagtctctacaatta |
119 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| ||||||||||||||||||| ||| |||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
25954151 |
aacaatgtttagatcagataacatgtatctcttctaatttagggagagtttgccgccgaattggatcacaaaaaactcgaaagattagtctctacaattg |
25954052 |
T |
 |
| Q |
120 |
cgcgtgcggatgatactcaatttacaac--caaaaaatattccttttcatatgtcccattcattacac--atatcgtcaaaatccttaaaatatcatttt |
215 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
25954051 |
tgcgtgcagatgatactcaatttacaacaaaaaaaaatattccttttcatttgtcccattcattacacatatatcgt-aaaatccttaaaatatcatttt |
25953953 |
T |
 |
| Q |
216 |
ggtataacaatgattttttcagtagaataat |
246 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |
|
|
| T |
25953952 |
ggtataacaatgattttttcaatagaataat |
25953922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University