View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4703_high_18 (Length: 240)
Name: NF4703_high_18
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4703_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 69 - 222
Target Start/End: Complemental strand, 36167717 - 36167566
Alignment:
| Q |
69 |
aaagatttcaggctcatacccccgccgttagcttctctcttttccaa-tttgtggaccctggataataaacatgcatgctaaatttattatcaatctaat |
167 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36167717 |
aaagatttcaggctcataaccccgccgttagcttctctcttttccaattttgtggaccctggataataaa----catgctaaatttattatcaatctaat |
36167622 |
T |
|
| Q |
168 |
cattttcttcatacc-aacagttaaaaatttaaacgtgacaaataacggaaagagt |
222 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36167621 |
cattttcttcataccaaacagttaaaaatttaaacgtgacaaataacggaaagagt |
36167566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University