View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4703_high_21 (Length: 208)
Name: NF4703_high_21
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4703_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 184
Target Start/End: Complemental strand, 14503283 - 14503116
Alignment:
| Q |
17 |
atgttttccatttttgttgctcttagaagttagaaaattccaatcagtcaattactataaaatttgaaaattcatagctagaaataaagggactgctggc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14503283 |
atgttttccatttttgttgctcttagaagttagaaaattccaattagtcaattactataaaatttgaaaattcatagctagaaataaagggactgctggc |
14503184 |
T |
 |
| Q |
117 |
aaaatggtaggcatcattgcttgaacccaaaaaggagaaacactgtgaaacaaaggcaacttaattta |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14503183 |
aaaatggtaggcatcattgcttgaacccaaaaaggagaaacactgtgaaacaaaggcaacttaattta |
14503116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University