View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4703_high_22 (Length: 207)

Name: NF4703_high_22
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4703_high_22
NF4703_high_22
[»] chr8 (1 HSPs)
chr8 (1-202)||(23628331-23628532)


Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 23628532 - 23628331
Alignment:
1 tggacacgagagagtttgggccgtgggtccagttttgccacttgaatccggtttaactgaaccggaagaaagaggtggtgcaagcactgtctcgtgtcac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23628532 tggacacgagagagtttgggccgtgggtccagttttgccacttgaatccggtttaactgaaccggaagaaagaggtggtgcaagcactgtctcgtgtcac 23628433  T
101 gaactaaccgcatggctcgaccgtctcgaaaacggttcggtggtttacgtttgttttggaagccgtacagttcttactacagcagagatggaggttttga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23628432 gaactaaccgcatggctcgaccgtctcgaaaacggttcggtggtttacgtttgttttggaagccgtacagttcttactacagcagagatggaggttttga 23628333  T
201 ca 202  Q
    ||    
23628332 ca 23628331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University