View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4703_low_24 (Length: 243)
Name: NF4703_low_24
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4703_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 227
Target Start/End: Original strand, 55396916 - 55397131
Alignment:
| Q |
12 |
catcatcatctggagttctgaaagtgcgaaattcgtcccaaaaacgctgccactttggttcaatttcatggaaaggataagctctgttaaccggcttctt |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55396916 |
catcatcatctggagttctgaaagtgcaaaattcgtcccaaaaacgctgccactttggttcaatttcatggaaaggataagctctgttaaccggcttctt |
55397015 |
T |
 |
| Q |
112 |
ctgctccgtttcgttcagtttaacatcattcgtcgacgagtttctgagtctgcgagtgaaactacggaatctgagagtagaaaaggaggttcttcttctg |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55397016 |
ctgctccgtttcgttcagttgaacatcattcgtcgacgagtttctgagtctgcgagtgaaactacggaatctgagagtagaaaaggaggttcttcttctg |
55397115 |
T |
 |
| Q |
212 |
attggtgtgggaaaag |
227 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
55397116 |
attggtgtgggaaaag |
55397131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University