View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4703_low_25 (Length: 240)

Name: NF4703_low_25
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4703_low_25
NF4703_low_25
[»] chr4 (1 HSPs)
chr4 (69-222)||(36167566-36167717)


Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 69 - 222
Target Start/End: Complemental strand, 36167717 - 36167566
Alignment:
69 aaagatttcaggctcatacccccgccgttagcttctctcttttccaa-tttgtggaccctggataataaacatgcatgctaaatttattatcaatctaat 167  Q
    |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    ||||||||||||||||||||||||||    
36167717 aaagatttcaggctcataaccccgccgttagcttctctcttttccaattttgtggaccctggataataaa----catgctaaatttattatcaatctaat 36167622  T
168 cattttcttcatacc-aacagttaaaaatttaaacgtgacaaataacggaaagagt 222  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
36167621 cattttcttcataccaaacagttaaaaatttaaacgtgacaaataacggaaagagt 36167566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University