View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4703_low_26 (Length: 227)
Name: NF4703_low_26
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4703_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 57 - 222
Target Start/End: Complemental strand, 3571053 - 3570887
Alignment:
| Q |
57 |
taaactaagtctaaagtgacagtaattttagtaacggtaattttcgtagttaattgtccttttaccgtaggtataaccgcaagtacttaaacacacatat |
156 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3571053 |
taaactaagtctaaagtgatagtaattttagtaacggtaattttcgtagttaattgtccttttatcgtaggtataaccgcaagtacttaaacccacatat |
3570954 |
T |
 |
| Q |
157 |
tttttgtcgtcgctatagtct-aaagtgacaaattttacttgttaaacaaaaccttttgttttacct |
222 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570953 |
ttttggtcgtcgctatagtctaaaagtgacagattttacttgttaaacaaaaccttttgttttacct |
3570887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 3571109 - 3571072
Alignment:
| Q |
1 |
cgaaattctgatcatttgtatttgggcacacataaggg |
38 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3571109 |
cgaaatcctgatcatttgtatttgggcacacataaggg |
3571072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University