View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4703_low_9 (Length: 379)
Name: NF4703_low_9
Description: NF4703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4703_low_9 |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0291 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 107 - 367
Target Start/End: Complemental strand, 13274 - 13019
Alignment:
| Q |
107 |
tacattttctgttgttggtgtcattgaaaaagttaaacatggtttgttaggtatgatttgaaaggtttgttataattagaaattcaaaaacatcgagatt |
206 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| || |
|
|
| T |
13274 |
tacactttctattgttggtgtcattgaaaaagttaaacatggtttgttaggtatgatttaacaggtttgttataattagaaattcaaaaacatcga--tt |
13177 |
T |
 |
| Q |
207 |
ccctcatttttgaacttacgtttctctccattctcactaaggaagctttccgaacccatcaccaccaccacctctgccctttaccacccaaaaatccaaa |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13176 |
ccctcatttttgaacttacgtttctctccattctaactaaggaagctttcccaaccca---ccaccaccacctccgccctttaccacccaaaaatccaaa |
13080 |
T |
 |
| Q |
307 |
tccgggtgtcaagatgtagatccatgttcttggtggtgtgatatcgagcttgtttgcttca |
367 |
Q |
| |
|
||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13079 |
tccagttgtcaagatgtagatccatgttcttggtggtgtgatatcgagcttgtttgcttca |
13019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 154
Target Start/End: Original strand, 40368092 - 40368128
Alignment:
| Q |
118 |
ttgttggtgtcattgaaaaagttaaacatggtttgtt |
154 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40368092 |
ttgttggtgtcattgaaaaagataaacatggtttgtt |
40368128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 8145201 - 8145238
Alignment:
| Q |
118 |
ttgttggtgtcattgaaaaagttaaacatggtttgtta |
155 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
8145201 |
ttgttggtgtcattgaaaaagataaacatgatttgtta |
8145238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 118 - 158
Target Start/End: Complemental strand, 30333909 - 30333869
Alignment:
| Q |
118 |
ttgttggtgtcattgaaaaagttaaacatggtttgttaggt |
158 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
30333909 |
ttgttggtgtcattgaaaaagataaacatgatttattaggt |
30333869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University