View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4704-Insertion-6 (Length: 110)
Name: NF4704-Insertion-6
Description: NF4704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4704-Insertion-6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 2e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 26 - 110
Target Start/End: Original strand, 49070566 - 49070651
Alignment:
| Q |
26 |
tctttggtaaatttggaaatgtggctagtgtgagggtgttgcaagatttgaatcagggg-gaaaaaagccgtgtctatgcctttgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49070566 |
tctttggtaaatttggaaatgtggctagtgtgagggtgttgcaagatttgaatcaggggaaaaaaaagccgtgtctatgcctttgt |
49070651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University