View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4704-Insertion-8 (Length: 90)
Name: NF4704-Insertion-8
Description: NF4704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4704-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 86
Target Start/End: Complemental strand, 36207956 - 36207912
Alignment:
| Q |
42 |
ataaaattgtttatagatgtcctacatatatatctcataggttta |
86 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36207956 |
ataaaattctttatagatgtcctacatatatatctcatagattta |
36207912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 42 - 86
Target Start/End: Complemental strand, 9767778 - 9767734
Alignment:
| Q |
42 |
ataaaattgtttatagatgtcctacatatatatctcataggttta |
86 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9767778 |
ataaaattctttatagatgtcctacatatacatctcataggttta |
9767734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University