View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4704_high_12 (Length: 386)
Name: NF4704_high_12
Description: NF4704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4704_high_12 |
 |  |
|
| [»] scaffold0339 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0339 (Bit Score: 272; Significance: 1e-152; HSPs: 3)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 11 - 286
Target Start/End: Complemental strand, 16240 - 15965
Alignment:
| Q |
11 |
caaaggggttcacagtgaatgcatttaagtgcatgtttgaattgacacgagtttcatagaaccgcggtgtcactgtgattccaaacatacacaatgaaac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16240 |
caaaggggttcacagtgaatgcatttaagtgcatgtttgaattgacacgagtttcatagaaccgtggtgtcactgtgattccaaacatacacaatgaaac |
16141 |
T |
 |
| Q |
111 |
gagatataccttattcaaagctatattagctttttgcacccaatcagcatccttgcctttccctaatacagaaccagctgaagttagatcattttgttca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16140 |
gagatataccttattcaaagctatattagctttttgcacccaatcagcatccttgcctttccctaatacagaaccagctgaagttagatcattttgttca |
16041 |
T |
 |
| Q |
211 |
attgcttgaccaacttcactcaatttgtacaccaagtcttgaagataccctgcaattatttttcattcgttagtac |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16040 |
attgcttgaccaacttcactcaatttgtacaccaagtcttgaagataccctgcaattatttttcattcgttagtac |
15965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 11 - 70
Target Start/End: Original strand, 2866 - 2925
Alignment:
| Q |
11 |
caaaggggttcacagtgaatgcatttaagtgcatgtttgaattgacacgagtttcataga |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2866 |
caaaggggttcacagtgaatgcatttaagtgcatgtttgaattgacacgagtttcataga |
2925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 306 - 371
Target Start/End: Complemental strand, 15945 - 15879
Alignment:
| Q |
306 |
ttgtccctgctgaacttgagaactcagcnnnnnnn-ctggtgttttgagttttttcatgaaggaact |
371 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15945 |
ttgtccctgctgaacttgagaactcagcaaaaaaaactggtgttttgagttttttcatgaaggaact |
15879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 11 - 70
Target Start/End: Original strand, 47273641 - 47273700
Alignment:
| Q |
11 |
caaaggggttcacagtgaatgcatttaagtgcatgtttgaattgacacgagtttcataga |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47273641 |
caaaggggttcacagtgaatgcatttaagtgcatgtttgaattgacacgagtttcataga |
47273700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 92 - 129
Target Start/End: Original strand, 47296385 - 47296422
Alignment:
| Q |
92 |
caaacatacacaatgaaacgagatataccttattcaaa |
129 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47296385 |
caaacatacacaatgaaacaagatataccttattcaaa |
47296422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University