View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4704_high_31 (Length: 266)
Name: NF4704_high_31
Description: NF4704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4704_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 50707191 - 50706939
Alignment:
| Q |
1 |
caatcttcaataacactacaaacaggtgtgataggaggagaggtcttagtagcagtgctagnnnnnnnnnnnnnnn---agagaaaagataatagtagtg |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
50707191 |
caatcttcaataacactacaaacaggtgtgataggaagagaggtcttagtagtagtgctagttttttttttttttttttagagaaaagataatagtagtg |
50707092 |
T |
 |
| Q |
98 |
ctagttttatggttcctgattttggacactataggcatgaattgctatattagttttggttgggtgggtagcatatttcaatttgtttaaagttttttcg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50707091 |
ctagttttatggttcctgattttggacactataggcatgaattgctatattagttttggttgggt-agtagcatatttcaatttgtttaaagttttttcg |
50706993 |
T |
 |
| Q |
198 |
tatgttcgatgtcaacattctcttcaaaaataaaatatattatgtgtttatgtt |
251 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50706992 |
tatgttcgatgtcaacattctctttaaaaataaaatatattatgtgtttatgtt |
50706939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University