View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4704_high_32 (Length: 266)
Name: NF4704_high_32
Description: NF4704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4704_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 15 - 244
Target Start/End: Original strand, 29238619 - 29238848
Alignment:
| Q |
15 |
ttaagaagcatctcaatgttaatcttcttgtcatagtaattaacaacatcatttttgagaatttcaagtatcttatcagccacgaatctgacagtactga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29238619 |
ttaagaagcatctcaatgttaatcttcttgtcatagtaattaacagcatcatttttgagaatttcaagtatcttatcagccacgaatctgacagtactga |
29238718 |
T |
 |
| Q |
115 |
gcggctgaccggcaagaggctgaccagggcgtggctgctggataagagtgagcagattgttgtaggccgcgcgggttttgttacttttaggttggtagag |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29238719 |
gcggctgaccggcaagaggctgaccagggcgtggctgctggataagagtgagcagattgttgtaggccgcgcgggttttgttagttttaggttggtagag |
29238818 |
T |
 |
| Q |
215 |
gccgtcgtcgacgaccgggaagacgaactt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29238819 |
gccgtcgtcgacgaccgggaagacgaactt |
29238848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University