View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4704_low_11 (Length: 416)
Name: NF4704_low_11
Description: NF4704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4704_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 18 - 181
Target Start/End: Complemental strand, 5577638 - 5577475
Alignment:
| Q |
18 |
acttttatagcgttttatgagttagtttgtgatggttgtgtgttaattttgccatatgtaggatattttgcatgatttgtggttgattgtgaactgcatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5577638 |
acttttatagcgttttatgagttagtttgtgatgggtgtgtgttaattttgccatatgtaggatattttgcatgatttgtggttgattgtgaactgcgta |
5577539 |
T |
|
| Q |
118 |
tgtgaattttttcgctttaatgaaatgaggtgtatatattgttttgatagatttgaaatcacgg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5577538 |
tgtgaattttttcgctttaatgaaatgaggtgtatatattgttttgatagatttgaaatcacgg |
5577475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 257 - 406
Target Start/End: Complemental strand, 5577401 - 5577253
Alignment:
| Q |
257 |
aatggtggaactgaaattcctatatgccccagtagagagatatgtttgaccactgttgttggtttctctttatgattttacatgaannnnnnnnnaccac |
356 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| || ||||| ||||| || |||||||||||||||||||||||||||| | ||| |
|
|
| T |
5577401 |
aatgggggaactgaaattcctatatgccccagtagagaggtaagtttggccactattattggtttctctttatgattttacatgaa-ttttttttagcac |
5577303 |
T |
|
| Q |
357 |
aattgtgcttaaatttttctattccctctctttaaattgcggatcctttg |
406 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
5577302 |
aattgtgcttaaatttttctactccctctctttaaattgcagatcctttg |
5577253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 29 - 95
Target Start/End: Complemental strand, 5936335 - 5936269
Alignment:
| Q |
29 |
gttttatgagttagtttgtgatggttgtgtgttaattttgccatatgtaggatattttgcatgattt |
95 |
Q |
| |
|
||||| ||||||| ||||| |||| | |||||||||||||| |||||||| || ||||||||||||| |
|
|
| T |
5936335 |
gttttgtgagttaatttgttatgggtatgtgttaattttgctatatgtagtatcttttgcatgattt |
5936269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University