View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4704_low_38 (Length: 243)
Name: NF4704_low_38
Description: NF4704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4704_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 13 - 202
Target Start/End: Original strand, 25295165 - 25295354
Alignment:
| Q |
13 |
aagaacatgtagacaaatactacatatacaatgtgtaggaaaattctgattattatttgaatttttatttagttctttcgtttctaaaaccatgtatcca |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| | |||| | |
|
|
| T |
25295165 |
aagaacatgtagacaaattctacatatacaatgtgtaggaaaattccgattattatttgaatttttatttagttctttcatttctaaaactaagtatacg |
25295264 |
T |
|
| Q |
113 |
aaagggactaccttggtgaattttacttttggaagtttgatgattagtttatggatgataataattctgggataaattgcaattgtgtgg |
202 |
Q |
| |
|
||||| || | ||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25295265 |
aaaggtaccaacttagtgaattttgctttcggaagtttgatgattagtttatggatgataataattctgggataaattgcaattgtgtgg |
25295354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University