View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4704_low_42 (Length: 238)
Name: NF4704_low_42
Description: NF4704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4704_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 25295367 - 25295578
Alignment:
| Q |
1 |
taaattcttaaccatataatgtgtcataactttgtatcggtaacttattgaggaaaggaaatatcattatt------------atagtcactttggtgca |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
25295367 |
taaattcttaaccatataatgtgtcataactttgtatcggtaacttattgaggaaaggaaatatcattcttcatgccatttctatagtcactttggtgca |
25295466 |
T |
|
| Q |
89 |
gtgacacgttgacattccaaaaactcacatcatcacaacaattatggaagggaaaaaataaggttcaatgaaaccttaataatc-tatgaaaccacatat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25295467 |
gtgacacgttgacattccaaaaactcacatcatcagaacaattatggaagggaaaaaattaggttcaatgaaaccttaataatcttatgaaaccacatat |
25295566 |
T |
|
| Q |
188 |
attatacgattt |
199 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25295567 |
attatacgattt |
25295578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University