View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4704_low_46 (Length: 227)
Name: NF4704_low_46
Description: NF4704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4704_low_46 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0437 (2 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0114 (1 HSPs) |
 |  |  |
|
| [»] scaffold0196 (1 HSPs) |
 |  |  |
|
| [»] scaffold0292 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 5e-43; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 88 - 220
Target Start/End: Original strand, 9078806 - 9078941
Alignment:
| Q |
88 |
atgttccaaaacaagtaaaaag-ggggaaatgtgaaataaagg--aaacaacttacaattttgtcaaatagttctcctccattaaccaactccaagacaa |
184 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9078806 |
atgttccaaaacaagtaaaaaatggggaaatatgaataaaagatcaaacaacttacaattttgtcaaatagttctcctccattaaccaactccaaaacaa |
9078905 |
T |
 |
| Q |
185 |
tgtaaatctttgttttgcttgccatcacctatgctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9078906 |
tgtaaatctttgttttgcttgccatcacctgtgctt |
9078941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 88 - 220
Target Start/End: Original strand, 9087583 - 9087718
Alignment:
| Q |
88 |
atgttccaaaacaagtaaaaag-ggggaaatgtgaaataaagg--aaacaacttacaattttgtcaaatagttctcctccattaaccaactccaagacaa |
184 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9087583 |
atgttccaaaacaagtaaaaaatggggaaatatgaataaaagatcaaacaacttacaattttgtcaaatagttctcctccattaaccaactccaaaacaa |
9087682 |
T |
 |
| Q |
185 |
tgtaaatctttgttttgcttgccatcacctatgctt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9087683 |
tgtaaatctttgttttgcttgccatcacctgtgctt |
9087718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 18036877 - 18036807
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccg |
71 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
18036877 |
atggaggttcctcggggtgccaacatagttgggatgtcggtgtttcctcttgatgtttgtcctctctcccg |
18036807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 16290873 - 16290941
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| | |||||||||| ||||||| ||||| |
|
|
| T |
16290873 |
atggaggtttcccggggtgccaacctagttgggatgtcggtgttgcctcttgatgtttgtcctttctcc |
16290941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 24184812 - 24184743
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctccc |
70 |
Q |
| |
|
||||||| | |||||| ||||| ||||||||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
24184812 |
atggagggttcccgggatgccaacctagttgggatgtcggtgttccctcttgatgtttgtcctctctccc |
24184743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 26657684 - 26657752
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||||| |||| |||||| | ||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
26657684 |
atggaggtttcccgaagtgccaacttagttgggatgtcggtgtttcctcttgatgcatgtcctctctcc |
26657752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 72
Target Start/End: Original strand, 24317426 - 24317487
Alignment:
| Q |
11 |
cccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccgg |
72 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||| |||||||||||| ||| ||||||||||| |
|
|
| T |
24317426 |
cccggggtgccaacctagttggtatgttggtgtttcctcttgatgtatgttctctctcccgg |
24317487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 26867475 - 26867541
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctct |
67 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||||||| || | |||||||| | |||||||||| |
|
|
| T |
26867475 |
atggaggtttcccgaggtgccaacctagttgggatgtcgatgatgcctcttgaagcctgtcctctct |
26867541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 19742059 - 19742100
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtg |
42 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
19742059 |
atggaggcttcccggggtgccaacctagttgggatgtcggtg |
19742100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 21593212 - 21593268
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| ||||||||| |||||| || | |||||||||| |||||||||||| |
|
|
| T |
21593212 |
cggggtgccaacctagttggaatgtcgatgatgcctcttgatgcctgtcctctctcc |
21593268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 1555 - 1487
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
1555 |
atggaggtttcccggggtgccaacctagttgggatgtcggtgttgcctcttgatgcttgtcctctctcc |
1487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 5e-18; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 19054446 - 19054392
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
19054446 |
atggaggttccccggggtgccaacctagttgggatgtcggtgtttcctcttgatg |
19054392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 16816295 - 16816217
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccggttcatcc |
79 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||| |||| |||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
16816295 |
atggaggttccccgaggcgccaacctagttgggatgttggtgtttcctcttgatgcatgtccactctcccggtttatcc |
16816217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 10433214 - 10433282
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| ||| ||||| | ||||||||||||||||||| |||||||||||| ||||||| ||||| |
|
|
| T |
10433214 |
atggaggttctccgaggtgcaaacctagttgggatgtcggtgcttcctcttgatgcttgtcctttctcc |
10433282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 34528980 - 34528926
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||| || |||||||||||| |
|
|
| T |
34528980 |
atggaggtttcccggggtgccaacctagttgggatgtcgctgtttcctcttgatg |
34528926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 10423862 - 10423794
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||||| || | |||||||||| |||||| |||||| |
|
|
| T |
10423862 |
atggaggtttctcggggtgccaacctagttgggatgtcgatgttgcctcttgatgcttgtccactctcc |
10423794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 18332762 - 18332702
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtc |
61 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| || || ||||| ||| ||||| |
|
|
| T |
18332762 |
atggaggttctccggggtgccaacctagttgggatgtcgatgttttctcttaatgcttgtc |
18332702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 27035901 - 27035845
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||| ||||| |||||||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
27035901 |
cgggatgccaacctagttgggatgtcgatgatgcctcttgatgcttgtcctctctcc |
27035845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 13309428 - 13309367
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccggtt |
74 |
Q |
| |
|
|||||||||| |||||||||||||||| || | |||||||||| ||||| |||||| |||| |
|
|
| T |
13309428 |
cggggtgccaacctagttgggatgtcgatgatgcctcttgatgcctgtccactctcctggtt |
13309367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 33012786 - 33012839
Alignment:
| Q |
16 |
ggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||| |||||||||||||||| || ||| ||||||| ||||||||||||| |
|
|
| T |
33012786 |
ggtgccaacctagttgggatgtcgttgcttctccttgatgtttgtcctctctcc |
33012839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0437 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0437
Description:
Target: scaffold0437; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 11431 - 11500
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctccc |
70 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
11431 |
atggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatgtttgtcctctctccc |
11500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0437; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 14379 - 14323
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||| ||||| |||||||||||||||| || | |||||||||| |||||||||||| |
|
|
| T |
14379 |
cgggatgccaacctagttgggatgtcgatgatgcctcttgatgtctgtcctctctcc |
14323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 14)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 14641453 - 14641522
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctccc |
70 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
14641453 |
atggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatgtttgtcctctctccc |
14641522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 8483690 - 8483615
Alignment:
| Q |
4 |
gaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccggttcatcc |
79 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||| ||||| | ||||||||| |||| |
|
|
| T |
8483690 |
gaggttccccggggtgccaacctagttgggatgtccgtgtttcctcttgatgcatgtccacgctcccggtttatcc |
8483615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 2 - 69
Target Start/End: Original strand, 20898980 - 20899047
Alignment:
| Q |
2 |
tggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
20898980 |
tggaggtttcctggggtgccaacctagttgggatgtcggtgttgcctcttgatgcttgtcctctctcc |
20899047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 24617794 - 24617716
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccggttcatcc |
79 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||| |||||||||||| ||||| | ||||||||| |||| |
|
|
| T |
24617794 |
atggaggttttccggggtgccaacctagttgggatgtcggtgtttcctcttgatgcatgtccacgctcccggtttatcc |
24617716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 20589650 - 20589728
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccggttcatcc |
79 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| |||||||| ||| |||||||||| |||||| ||||| |||| |||| |
|
|
| T |
20589650 |
atggaggttctccggggtgccaacctagttgagatgtcggaggtccctcttgatgcctgtcctttctcctggtttatcc |
20589728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 34338143 - 34338087
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||||||||||||| |||| ||||||| |
|
|
| T |
34338143 |
cggggtgccaacctagttgggatgtcgatgattcctcttgatggctgtcatctctcc |
34338087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 5 - 55
Target Start/End: Complemental strand, 15141961 - 15141911
Alignment:
| Q |
5 |
aggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
||||| |||||| ||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
15141961 |
aggtttcccgggttgccaacctagttgggatgtcggtgtttcctcttgatg |
15141911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 70
Target Start/End: Original strand, 13575022 - 13575087
Alignment:
| Q |
5 |
aggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctccc |
70 |
Q |
| |
|
||||| ||||| |||||| ||||||||||||||||||| | |||||||||| |||| |||||||| |
|
|
| T |
13575022 |
aggtttcccggagtgccaacctagttgggatgtcggtgttccctcttgatgcatgtcttctctccc |
13575087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 70
Target Start/End: Original strand, 13577561 - 13577626
Alignment:
| Q |
5 |
aggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctccc |
70 |
Q |
| |
|
||||| ||||| |||||| ||||||||||||||||||| | |||||||||| |||| |||||||| |
|
|
| T |
13577561 |
aggtttcccggagtgccaacctagttgggatgtcggtgttccctcttgatgcatgtcttctctccc |
13577626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 7242936 - 7242877
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgt |
60 |
Q |
| |
|
|||| |||||| |||||||||| |||||||||||||||| | |||||||||||| |||| |
|
|
| T |
7242936 |
atgggggttcctcggggtgccaacctagttgggatgtcgtcgcttcctcttgatgcttgt |
7242877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 69
Target Start/End: Original strand, 11319501 - 11319554
Alignment:
| Q |
16 |
ggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||| |||||||| ||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
11319501 |
ggtgccaacctagttgagatgttggtgcttcctcttgatgcatgtcctctctcc |
11319554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 70
Target Start/End: Original strand, 13565946 - 13565999
Alignment:
| Q |
17 |
gtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctccc |
70 |
Q |
| |
|
|||||| |||||||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
13565946 |
gtgccaacctagttgggatgtcgttgttccctcttgatgcatgtcctctctccc |
13565999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 13570494 - 13570551
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctccc |
70 |
Q |
| |
|
|||||||||| ||||||||||||| |||| | |||||||||| ||||||||||||| |
|
|
| T |
13570494 |
cggggtgccaatctagttgggatgtaggtgttccctcttgatgcatgtcctctctccc |
13570551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 12435983 - 12436039
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| |||||||||||||||| || | |||| ||||| |||||||||||| |
|
|
| T |
12435983 |
cggggtgccaacctagttgggatgtcgatgatgcctcctgatgcatgtcctctctcc |
12436039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 15614754 - 15614823
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctccc |
70 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||||| | |||||||||| |||||||||||||| |
|
|
| T |
15614754 |
atggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatgcttgtcctctctccc |
15614823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 21711599 - 21711531
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
21711599 |
atggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatgcttgtcctctctcc |
21711531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 2259458 - 2259388
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccg |
71 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
2259458 |
atggaggtttcccgggatgccaacctagttgggatgtcggtgtttcctcttgatgcatgtccactctcccg |
2259388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 70
Target Start/End: Original strand, 4120550 - 4120605
Alignment:
| Q |
15 |
gggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctccc |
70 |
Q |
| |
|
|||||||| ||||||||||||||||||| | |||||||||| || ||||||||||| |
|
|
| T |
4120550 |
gggtgccaacctagttgggatgtcggtgttccctcttgatgtttatcctctctccc |
4120605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 21877950 - 21877894
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| |||||||||||||||| || | || ||||||| |||||| |||||| |
|
|
| T |
21877950 |
cggggtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccactctcc |
21877894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 55
Target Start/End: Complemental strand, 24765560 - 24765508
Alignment:
| Q |
3 |
ggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
24765560 |
ggaggtttcccgggatgccaatctagttgggatgtcggtatttcctcttgatg |
24765508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 2311 - 2379
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
2311 |
atggagggttcccggggtgccaacctagttgggatgtcggtgttccctcttgatgcttgtcctctctcc |
2379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 1051378 - 1051310
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
1051378 |
atggaggtttcccgaggtgccaacctagttgggatgtcggtgttccctcttgatgtttgtcctctctcc |
1051310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 10623296 - 10623242
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
10623296 |
atggaggttccccggggtgccaacctagttaggatgtcggtgtttcctcttgatg |
10623242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 25760053 - 25760105
Alignment:
| Q |
17 |
gtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||| ||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
25760053 |
gtgccaacctagttgggatgtcggtgttgcctcttgatgcttgtcctctctcc |
25760105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 16309726 - 16309658
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||||||||| | | |||||||||| |||||||||||| |
|
|
| T |
16309726 |
atggaggttctccggggtgccaacttagttgggatgtcgaagctacctcttgatgtctgtcctctctcc |
16309658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 18490720 - 18490652
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||||||||| | | |||||||||| |||||||||||| |
|
|
| T |
18490720 |
atggaggttctccggggtgccaacttagttgggatgtcgaagctacctcttgatgtctgtcctctctcc |
18490652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 26953995 - 26953944
Alignment:
| Q |
18 |
tgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
26953995 |
tgccaacctagttgggatgtcggtgtttcctcttgatgcatgtcgtctctcc |
26953944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 74
Target Start/End: Original strand, 19185105 - 19185166
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccggtt |
74 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||| ||||||| |||||||||||| |||| |
|
|
| T |
19185105 |
cggggtgccaacctagttgggatgtcgttgcttctccttgatgcctgtcctctctcctggtt |
19185166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 3736510 - 3736566
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| |||||||||||||||| || | || ||||||| |||||| |||||| |
|
|
| T |
3736510 |
cggggtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccactctcc |
3736566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 26430286 - 26430342
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| ||||||| |||||||| || | |||||||||| |||||||||||| |
|
|
| T |
26430286 |
cggggtgccaacctagttaggatgtcgatgatgcctcttgatgtatgtcctctctcc |
26430342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 4 - 55
Target Start/End: Complemental strand, 34657971 - 34657920
Alignment:
| Q |
4 |
gaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
34657971 |
gaggttccccggggtgccaacctagttgggatgtcggtgtttcctcttgatg |
34657920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 4 - 69
Target Start/End: Complemental strand, 37005959 - 37005894
Alignment:
| Q |
4 |
gaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
||||||| ||||||||||| |||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
37005959 |
gaggttctccggggtgccaacctaattgggatgtcggtgcttcctcttgatgcatgtcctctctcc |
37005894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 11416022 - 11415968
Alignment:
| Q |
15 |
gggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||| | ||||||||||||||||| ||||| |||||| ||||||||||||| |
|
|
| T |
11416022 |
gggtgccaacttagttgggatgtcggtgtttccttttgatgtttgtcctctctcc |
11415968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 19298871 - 19298816
Alignment:
| Q |
1 |
atggaggttccccgggg-tgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| |||||| ||| |||||||||||| |
|
|
| T |
19298871 |
atggaggttccccgggggtgccaacctagttgagatgtcagtgtttcctcttgatg |
19298816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 74
Target Start/End: Original strand, 34512087 - 34512150
Alignment:
| Q |
11 |
cccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccggtt |
74 |
Q |
| |
|
|||||||||||| |||||||||||||||| || | |||||||||| ||||| |||||| |||| |
|
|
| T |
34512087 |
cccggggtgccaacctagttgggatgtcgatgatgcctcttgatgcctgtccactctcctggtt |
34512150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 980936 - 981004
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||||||||| | | |||||||||| ||||||||||||| |
|
|
| T |
980936 |
atggaggttctccggagtgccaacctagttgggatgtcggagctgcctcttgatgtttgtcctctctcc |
981004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 12163412 - 12163466
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
12163412 |
atggaggtttcccgaggtgccaacctagttgggatgtcggtgttgcctcttgatg |
12163466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 78
Target Start/End: Original strand, 10996404 - 10996468
Alignment:
| Q |
14 |
ggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccggttcatc |
78 |
Q |
| |
|
||||||||| | |||||| ||| |||||| |||||||||||| || |||||||||||| |||||| |
|
|
| T |
10996404 |
ggggtgccaacttagttgagatatcggtgtttcctcttgatgtttttcctctctcccgattcatc |
10996468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 1538019 - 1537965
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
||||||||| ||| |||| || ||||||||||||||||||| |||||||||||| |
|
|
| T |
1538019 |
atggaggtttccctaggtggcaacctagttgggatgtcggtgtttcctcttgatg |
1537965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 1862388 - 1862350
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcg |
39 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
1862388 |
atggaggttctccggggtgccaacctagttgggatgtcg |
1862350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 69
Target Start/End: Original strand, 1633324 - 1633389
Alignment:
| Q |
4 |
gaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||| | ||||||| || ||||||||| |||||||| |||||||||||| |||||||||||| |
|
|
| T |
1633324 |
gaggtttctcggggtgtcaacctagttggattgtcggtgtttcctcttgatgcatgtcctctctcc |
1633389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0114 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0114
Description:
Target: scaffold0114; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 3037 - 2959
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcccggttcatcc |
79 |
Q |
| |
|
|||||||||||||||| ||||| |||| | |||||||||||| |||||||||||| ||||| | ||||||||| |||| |
|
|
| T |
3037 |
atggaggttccccgggatgccaacctaatcgggatgtcggtgtttcctcttgatgcatgtccacgctcccggtttatcc |
2959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 1490671 - 1490725
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||||||| ||| |||||||||| |
|
|
| T |
1490671 |
atggaggttctccggggtgacaacctagttgggatgtcggaggtccctcttgatg |
1490725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 40926522 - 40926468
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||| || |||||| ||||| |
|
|
| T |
40926522 |
atggaggtttcccggggtgccaacctagttgggatgtcgatgtttcctcctgatg |
40926468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 28522869 - 28522937
Alignment:
| Q |
1 |
atggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
28522869 |
atggaggttctctagggtgccaacctagttgggatgtcaatgtttcctcttgatgtctgtcctctctcc |
28522937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 17679763 - 17679707
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| |||||||||||||||| || | || ||||||| |||||| |||||| |
|
|
| T |
17679763 |
cggggtgccaacctagttgggatgtcgatgatgccgcttgatgtttgtccactctcc |
17679707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 20477454 - 20477510
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| |||||||||||||||| || | |||||||||| |||||| ||||| |
|
|
| T |
20477454 |
cggggtgccaacctagttgggatgtcgatgatgcctcttgatgtctgtcctttctcc |
20477510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0196
Description:
Target: scaffold0196; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 55
Target Start/End: Original strand, 793 - 835
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
|||||||||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
793 |
cggggtgccaacctagttgggatgtcggtgttgcctcttgatg |
835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0292 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0292
Description:
Target: scaffold0292; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 21249 - 21305
Alignment:
| Q |
13 |
cggggtgccatcctagttgggatgtcggtggttcctcttgatggttgtcctctctcc |
69 |
Q |
| |
|
|||||||||| |||||||||||||||| || | |||||||||| ||||| |||||| |
|
|
| T |
21249 |
cggggtgccaacctagttgggatgtcgatgatgcctcttgatgcctgtccactctcc |
21305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 55
Target Start/End: Complemental strand, 8057 - 8005
Alignment:
| Q |
3 |
ggaggttccccggggtgccatcctagttgggatgtcggtggttcctcttgatg |
55 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
8057 |
ggaggtttcccgggatgccaatctagttgggatgtcggtatttcctcttgatg |
8005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University