View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4705_low_1 (Length: 272)
Name: NF4705_low_1
Description: NF4705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4705_low_1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 147 - 272
Target Start/End: Original strand, 9289972 - 9290097
Alignment:
| Q |
147 |
atcatactgttctatttgaaatttatttaaatccaaccaaataaatttatagacattgttataaatttatttaaatacaactaaattaagagaacaatta |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9289972 |
atcatactgttctatttgaaatttatttaaatccaaccaaataaattgatagacattgttataaatttatttaaatacaactaaattaagagaacaatta |
9290071 |
T |
|
| Q |
247 |
ttatcaaaaattgtatcagcattatt |
272 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
9290072 |
ttatcaaaaattgtatcagcattatt |
9290097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University