View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4706-Insertion-11 (Length: 81)
Name: NF4706-Insertion-11
Description: NF4706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4706-Insertion-11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 5e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 5e-28
Query Start/End: Original strand, 7 - 81
Target Start/End: Original strand, 41977009 - 41977083
Alignment:
| Q |
7 |
aaaattttccctgttcattcttgttgaatctcttttgttctttgctcatgtaccgttaaattctgcctaatgttg |
81 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41977009 |
aaaaatttccctgttcattcttgttgaatctctttggttctttgctcatgtaccgttaaattctgcataatgttg |
41977083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University