View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4706-Insertion-13 (Length: 125)
Name: NF4706-Insertion-13
Description: NF4706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4706-Insertion-13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 30032893 - 30033011
Alignment:
| Q |
8 |
ttactcccacaatgttccaacttcaactttccttgttctct-tttgttgttttactcacaacttcaattttccaacttctcttgatcctcagaaggatta |
106 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30032893 |
ttactcctacaatgttccaacttcaactttccttgttctctctttgttgttttactcacaacttcaattttccaacttctcttgatcctcagaaggatta |
30032992 |
T |
 |
| Q |
107 |
tccttattcaagtattttt |
125 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30032993 |
tccttattcaagtattttt |
30033011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University